ID: 1062103550_1062103555

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1062103550 1062103555
Species Human (GRCh38) Human (GRCh38)
Location 9:134740584-134740606 9:134740613-134740635
Sequence CCGTCCTCCTTCTATCCATCCAG GATTTGTACTGAGTGCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 181, 4: 1389} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!