ID: 1062105764_1062105773

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1062105764 1062105773
Species Human (GRCh38) Human (GRCh38)
Location 9:134753944-134753966 9:134753983-134754005
Sequence CCGTTCTCCGGCGGCAGCGACGG CCAACTGCTGCATGTTTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48} {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!