ID: 1062108572_1062108579

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1062108572 1062108579
Species Human (GRCh38) Human (GRCh38)
Location 9:134769290-134769312 9:134769343-134769365
Sequence CCACATCACAAACTGCCCTTTCT ATCCCCACGCGCGCAGCTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!