ID: 1062113720_1062113733

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1062113720 1062113733
Species Human (GRCh38) Human (GRCh38)
Location 9:134796572-134796594 9:134796612-134796634
Sequence CCCTGGGAGTGAACTCTTCCGTA GCAGCCCTGGTCTTGGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 82} {0: 1, 1: 0, 2: 1, 3: 36, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!