ID: 1062117621_1062117634

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1062117621 1062117634
Species Human (GRCh38) Human (GRCh38)
Location 9:134817872-134817894 9:134817920-134817942
Sequence CCCCAGGGGAGCCCAGAGGGTGG ATGTCCATGGAGGCTGAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 391} {0: 1, 1: 0, 2: 6, 3: 90, 4: 738}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!