ID: 1062122657_1062122670

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1062122657 1062122670
Species Human (GRCh38) Human (GRCh38)
Location 9:134842019-134842041 9:134842067-134842089
Sequence CCGGGCAAGCGCAGCCCTGGGTA TGGAGCCAGACAGATTGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 166} {0: 1, 1: 0, 2: 0, 3: 24, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!