ID: 1062166932_1062166946

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1062166932 1062166946
Species Human (GRCh38) Human (GRCh38)
Location 9:135112617-135112639 9:135112658-135112680
Sequence CCAGTCGGTGGGTGACCCGTCCA ACTCTTGGGCGGGCGTCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!