ID: 1062174297_1062174305

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1062174297 1062174305
Species Human (GRCh38) Human (GRCh38)
Location 9:135152490-135152512 9:135152527-135152549
Sequence CCTCTGTGCTCCCTCTTCCTGGA CACCCCCCACAAGAGGAACTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 65, 4: 525} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!