ID: 1062177919_1062177933

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1062177919 1062177933
Species Human (GRCh38) Human (GRCh38)
Location 9:135174598-135174620 9:135174641-135174663
Sequence CCCTCTGCCGCTGGCCCCTGACT AGGGAGGCCCATGGGATGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!