ID: 1062181932_1062181938

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1062181932 1062181938
Species Human (GRCh38) Human (GRCh38)
Location 9:135195564-135195586 9:135195585-135195607
Sequence CCAACCACAGAATCAGGCGCAGC GCCCAGGGTGACACGCGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!