ID: 1062189515_1062189518

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1062189515 1062189518
Species Human (GRCh38) Human (GRCh38)
Location 9:135240633-135240655 9:135240648-135240670
Sequence CCAATGTCCGACTATTCCCAAGG TCCCAAGGCCTTCATCCTCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!