ID: 1062197977_1062197979

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1062197977 1062197979
Species Human (GRCh38) Human (GRCh38)
Location 9:135285119-135285141 9:135285139-135285161
Sequence CCCACACACACAGGCATGTGCAC CACACGTGACACGCGTCCCCAGG
Strand - +
Off-target summary No data {0: 8, 1: 10, 2: 6, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!