ID: 1062197994_1062198000

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1062197994 1062198000
Species Human (GRCh38) Human (GRCh38)
Location 9:135285242-135285264 9:135285262-135285284
Sequence CCCCCACACACAGGCATGTGCAC CACACGTGACACGGGTCCCCAGG
Strand - +
Off-target summary No data {0: 6, 1: 13, 2: 5, 3: 5, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!