ID: 1062218668_1062218680

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1062218668 1062218680
Species Human (GRCh38) Human (GRCh38)
Location 9:135402872-135402894 9:135402895-135402917
Sequence CCTCCATCAGCCCTCAACACCGG CCACCGAGGGCCCTGGGGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 54, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!