ID: 1062248722_1062248734

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1062248722 1062248734
Species Human (GRCh38) Human (GRCh38)
Location 9:135583742-135583764 9:135583791-135583813
Sequence CCGTGCACACAATGAACCTGACA GGCCTGTGGACGGGGGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 175} {0: 1, 1: 0, 2: 1, 3: 50, 4: 473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!