ID: 1062261501_1062261514

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1062261501 1062261514
Species Human (GRCh38) Human (GRCh38)
Location 9:135665359-135665381 9:135665390-135665412
Sequence CCTCCGCTGTCCCCCTCTGACCC ACCCCACCTCCTCTGAAGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 530} {0: 1, 1: 0, 2: 0, 3: 20, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!