ID: 1062261511_1062261523

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1062261511 1062261523
Species Human (GRCh38) Human (GRCh38)
Location 9:135665380-135665402 9:135665408-135665430
Sequence CCCCTCGGGGACCCCACCTCCTC TCCGGCCCAACCCTGGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 344} {0: 1, 1: 1, 2: 0, 3: 15, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!