ID: 1062267332_1062267336

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1062267332 1062267336
Species Human (GRCh38) Human (GRCh38)
Location 9:135693201-135693223 9:135693216-135693238
Sequence CCAGGCACCAAGACCGTGAGGCC GTGAGGCCACATCGCCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 305} {0: 1, 1: 0, 2: 0, 3: 15, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!