ID: 1062273110_1062273121

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1062273110 1062273121
Species Human (GRCh38) Human (GRCh38)
Location 9:135718734-135718756 9:135718773-135718795
Sequence CCCCTGGCAGGCTGTGAGCGAGC CTCGGGCTTCCTGTTTCCCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 27, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!