ID: 1062281483_1062281490

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1062281483 1062281490
Species Human (GRCh38) Human (GRCh38)
Location 9:135753867-135753889 9:135753887-135753909
Sequence CCTCGGGCAGCAAGTCCTTGCAG CAGTGGTGCTAGAGGGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 106} {0: 1, 1: 0, 2: 0, 3: 21, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!