ID: 1062290421_1062290434

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1062290421 1062290434
Species Human (GRCh38) Human (GRCh38)
Location 9:135791915-135791937 9:135791960-135791982
Sequence CCCTGAGCACCAGGTGGGCACTG ACAGTGGGGCCGCTCAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 259} {0: 1, 1: 0, 2: 1, 3: 27, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!