ID: 1062290802_1062290804

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1062290802 1062290804
Species Human (GRCh38) Human (GRCh38)
Location 9:135793537-135793559 9:135793557-135793579
Sequence CCCAGGTGGGGATGTGTGTGCAC CACCTCACCACGTTCACTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 247} {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!