ID: 1062305916_1062305919

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1062305916 1062305919
Species Human (GRCh38) Human (GRCh38)
Location 9:135907186-135907208 9:135907204-135907226
Sequence CCCGGCCGCAACAAAGGCGCCGC GCCGCCGCCCCTCGCCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35} {0: 1, 1: 0, 2: 4, 3: 50, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!