ID: 1062313350_1062313363

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1062313350 1062313363
Species Human (GRCh38) Human (GRCh38)
Location 9:135952070-135952092 9:135952114-135952136
Sequence CCCAGAAACAGGCCTGACTCAGG ATCTGTCCGCTGCAGATGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 214} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!