ID: 1062319543_1062319554

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1062319543 1062319554
Species Human (GRCh38) Human (GRCh38)
Location 9:135984105-135984127 9:135984119-135984141
Sequence CCAGCCCTCCTGTCCTCAGAGGA CTCAGAGGAGGACAGGGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 95, 4: 858}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!