ID: 1062335132_1062335140

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1062335132 1062335140
Species Human (GRCh38) Human (GRCh38)
Location 9:136061611-136061633 9:136061637-136061659
Sequence CCTGGACCCAGCAGGTCTACCCC CCCCAGCCTCAGCCCTCACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!