ID: 1062338343_1062338352

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1062338343 1062338352
Species Human (GRCh38) Human (GRCh38)
Location 9:136082312-136082334 9:136082342-136082364
Sequence CCCAAGGCCAAGTCCGGGCTCTG TGTGCCACGTGCTGAGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!