ID: 1062344287_1062344297

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1062344287 1062344297
Species Human (GRCh38) Human (GRCh38)
Location 9:136107687-136107709 9:136107726-136107748
Sequence CCAGGCTGCACCGAGCACAGGTG TGGCCCAGCTCCAGGCTGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 61, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!