ID: 1062363521_1062363537

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1062363521 1062363537
Species Human (GRCh38) Human (GRCh38)
Location 9:136198441-136198463 9:136198476-136198498
Sequence CCCACCAGGGGAAAAGCAGTGGT CCCAGGGCGGGGAGGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 145} {0: 1, 1: 0, 2: 9, 3: 68, 4: 642}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!