ID: 1062363523_1062363537

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1062363523 1062363537
Species Human (GRCh38) Human (GRCh38)
Location 9:136198445-136198467 9:136198476-136198498
Sequence CCAGGGGAAAAGCAGTGGTCCGG CCCAGGGCGGGGAGGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 90} {0: 1, 1: 0, 2: 9, 3: 68, 4: 642}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!