ID: 1062373361_1062373369

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1062373361 1062373369
Species Human (GRCh38) Human (GRCh38)
Location 9:136251645-136251667 9:136251674-136251696
Sequence CCCCCTTCCTGGCATAGGCGCTG CCCGTCCTCGTTCCTGCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154} {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!