ID: 1062373366_1062373373

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1062373366 1062373373
Species Human (GRCh38) Human (GRCh38)
Location 9:136251670-136251692 9:136251699-136251721
Sequence CCGCCCCGTCCTCGTTCCTGCTC ACTCTGACTGTTCTTGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 521} {0: 1, 1: 0, 2: 0, 3: 20, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!