ID: 1062379569_1062379589

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1062379569 1062379589
Species Human (GRCh38) Human (GRCh38)
Location 9:136280767-136280789 9:136280811-136280833
Sequence CCCACTCCCCCAGGCCTTCCTCA GGAGGGTGCAGGTTGTATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 616} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!