ID: 1062381717_1062381729

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1062381717 1062381729
Species Human (GRCh38) Human (GRCh38)
Location 9:136290085-136290107 9:136290135-136290157
Sequence CCGCTCGGGAAGACCACACGCCC TGACCTCCCTTGGGGGTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44} {0: 1, 1: 0, 2: 0, 3: 8, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!