ID: 1062388207_1062388213

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1062388207 1062388213
Species Human (GRCh38) Human (GRCh38)
Location 9:136323326-136323348 9:136323367-136323389
Sequence CCTCCTCATCCTGTTTGGTTTGA GCCTCCCACCGCAGACCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 198} {0: 1, 1: 0, 2: 1, 3: 33, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!