ID: 1062388932_1062388948

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1062388932 1062388948
Species Human (GRCh38) Human (GRCh38)
Location 9:136326552-136326574 9:136326603-136326625
Sequence CCCGGGGTCGCAGCTGCCTTTCA AAGGCCCAGGATGCTGTCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 187} {0: 1, 1: 0, 2: 0, 3: 15, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!