ID: 1062392123_1062392139

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1062392123 1062392139
Species Human (GRCh38) Human (GRCh38)
Location 9:136338057-136338079 9:136338083-136338105
Sequence CCTCCCCTCCCCTCCCCAGAAGG GGTGGGGTTCTAGGCTGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 175, 4: 1318} {0: 1, 1: 0, 2: 2, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!