ID: 1062400832_1062400833

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1062400832 1062400833
Species Human (GRCh38) Human (GRCh38)
Location 9:136371916-136371938 9:136371932-136371954
Sequence CCAGGTTGGGGTCGCTGAGCACC GAGCACCTGCTCCTCATCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 119} {0: 1, 1: 0, 2: 2, 3: 16, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!