ID: 1062411120_1062411124

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1062411120 1062411124
Species Human (GRCh38) Human (GRCh38)
Location 9:136425095-136425117 9:136425121-136425143
Sequence CCCGAGGACATTCTAGAAACTGC CAATTAGCCCTCGGTGTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 170} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!