ID: 1062415730_1062415740

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1062415730 1062415740
Species Human (GRCh38) Human (GRCh38)
Location 9:136448611-136448633 9:136448650-136448672
Sequence CCAGACACACCAGGAGGATGGAG CAGAGACACCAGGAGGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 27, 4: 332} {0: 11, 1: 4, 2: 6, 3: 49, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!