ID: 1062415747_1062415759

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1062415747 1062415759
Species Human (GRCh38) Human (GRCh38)
Location 9:136448685-136448707 9:136448727-136448749
Sequence CCAGAGACACCAGGAGAATGGAG AGACACCAGGAGGATGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 296} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!