ID: 1062415781_1062415786 |
View in Genome Browser |
Spacer: 5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1062415781 | 1062415786 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:136448808-136448830 | 9:136448836-136448858 |
Sequence | CCAGGAGGATGGAGGTGGGAAGC | CAGAGACACCAGGAGGATGGAGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 5, 2: 6, 3: 46, 4: 436} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |