ID: 1062416871_1062416876

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1062416871 1062416876
Species Human (GRCh38) Human (GRCh38)
Location 9:136455614-136455636 9:136455645-136455667
Sequence CCGCACGCTCGGGCTCGAGTGCT GGTGCAGGCACCGCCAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51} {0: 1, 1: 0, 2: 0, 3: 21, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!