ID: 1062424184_1062424192

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1062424184 1062424192
Species Human (GRCh38) Human (GRCh38)
Location 9:136498432-136498454 9:136498455-136498477
Sequence CCAAGAGGCCCCGCCCCGCAGGG AGCTGCCGCCACGCGTGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 279} {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!