ID: 1062424187_1062424192

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1062424187 1062424192
Species Human (GRCh38) Human (GRCh38)
Location 9:136498441-136498463 9:136498455-136498477
Sequence CCCGCCCCGCAGGGAGCTGCCGC AGCTGCCGCCACGCGTGTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!