ID: 1062424367_1062424374

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1062424367 1062424374
Species Human (GRCh38) Human (GRCh38)
Location 9:136499210-136499232 9:136499241-136499263
Sequence CCATCATGCATGCGGGCATCCAG CTCGGTTCCGGATCAGGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88} {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!