ID: 1062425554_1062425572

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1062425554 1062425572
Species Human (GRCh38) Human (GRCh38)
Location 9:136504583-136504605 9:136504632-136504654
Sequence CCATGGCGCCGGCCGTGAGGGGC AGAGTTGCGGGGATTGACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126} {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!