ID: 1062426624_1062426629

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1062426624 1062426629
Species Human (GRCh38) Human (GRCh38)
Location 9:136509039-136509061 9:136509057-136509079
Sequence CCGTCCACGCAGGTGCCACCGTT CCGTTGAAGCAGGAGCTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 62} {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!