ID: 1062426859_1062426870

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1062426859 1062426870
Species Human (GRCh38) Human (GRCh38)
Location 9:136510139-136510161 9:136510179-136510201
Sequence CCCGTCTCCTGTGCTTGGGGTCT TGTCCTCAAGCTCCAGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 199} {0: 1, 1: 0, 2: 1, 3: 35, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!