ID: 1062430088_1062430097

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1062430088 1062430097
Species Human (GRCh38) Human (GRCh38)
Location 9:136523064-136523086 9:136523100-136523122
Sequence CCGGCAGGTGGGGCCATGGAAGC GCAGATGTAGGAGGCCTCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 242} {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!